A practical reference on selank: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2026-06-15. Anything still debated is marked as such rather than presented as settled.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed as a stabilized analogue of tuftsin, a naturally occurring tetrapeptide fragment derived from the immunoglobulin heavy chain. The additional Pro-Gly-Pro segment at the carboxyl terminus is intended to slow enzymatic cleavage. The compound is usually described in the literature as a synthetic peptide with anxiolytic and cognitive-related activity, a label that reflects a research context rather than an approved therapeutic category.
Most published work on selank originates from a small number of research groups in the Russian Federation. A large share of that record appears in Russian-language journals, which limits access for readers who rely on English-indexed databases. Independent replication by laboratories outside the original research network is sparse in publicly available sources. This concentration of origin and language is a frequently noted feature when the compound is summarized in broader reviews of synthetic peptides.
Reported pharmacological effects center on reduced anxiety-like behavior in animal models and on measures of memory and learning. Proposed contributing mechanisms include modulation of GABAergic signaling, shifts in monoamine turnover, and changes in the activity of enzymes that degrade neuropeptides. Effects on the expression of genes linked to neuroplasticity have also been described. No single molecular target is widely accepted, and whether the behavioral findings arise from one pathway or several remains an open question.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
Published clinical evidence is limited. Most controlled trials were conducted in Russia, enrolled modest numbers of participants, and appeared in Russian-language journals, which restricts independent verification. Reported outcomes include lower anxiety scores, improved attention and memory measures, and changes in fatigue ratings. Reviews written in English note methodological limitations such as small samples and inconsistent endpoints. Whether the compound produces clinically meaningful benefit relative to established anxiolytics is therefore an open question rather than an established finding.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C33H57N11O9 | Derived from the seven-residue sequence |
| Molecular weight | About 751.9 g/mol | Average mass; the monoisotopic value is slightly lower |
| Residue count | Seven amino acids | Thr-Lys-Pro-Arg-Pro-Gly-Pro |
| Parent compound | Tuftsin (Thr-Lys-Pro-Arg) | Selank extends tuftsin at the C-terminus |
| Compound class | Synthetic short peptide | Studied in a research setting; not a licensed drug in most markets |
Outside its country of origin the compound is generally handled as a research chemical rather than an approved medicine. No regulatory approval from the United States Food and Drug Administration or the European Medicines Agency has been granted for human use. Identity and purity are normally checked by reverse-phase high-performance liquid chromatography, with mass spectrometry used to confirm the molecular mass. Lyophilised material is stored cold and desiccated, and repeated freeze-thaw cycles are avoided.
Published work on this peptide almost always uses intranasal delivery, with drops or a spray applied to the nasal mucosa. Some animal experiments have used subcutaneous or intraperitoneal injection, and a smaller number have compared routes directly. Oral administration is not a focus of the literature, because short peptides of this size are broken down by digestive enzymes and cross intestinal barriers poorly. How much of an intranasal dose reaches the bloodstream intact in humans remains an open question.
Animal studies have examined behaviour in tests of anxiety, memory retention and stress response, and several report changes in neurotrophic or neurotransmitter-related markers. The human evidence base is much smaller, consisting mainly of short trials conducted in Russia with limited reporting in English-language journals. Sample sizes are modest and outcome measures vary between studies, so the findings are best described as preliminary. Independent replication under modern trial standards has not been widely reported.
Selank is not a naturally occurring peptide and has no known endogenous counterpart in human physiology. Russian-language sources frequently call it TP-7, while English-language sources use the name Selank almost exclusively. Database indexing is uneven, partly because early reports appeared in regional journals that are not widely cataloged. Some summaries describe the material as a tuftsin analog and others as a synthetic heptapeptide; the labels overlap rather than conflict. Citing the primary sequence resolves ambiguity more reliably than the research or trade name alone.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro, written TKPRPGP in one-letter notation. Its structure consists of the immunomodulatory tetrapeptide tuftsin, Thr-Lys-Pro-Arg, extended at the carboxyl terminus by a Pro-Gly-Pro segment. The molecular formula is commonly given as C33H57N11O9, corresponding to a monoisotopic mass near 751.4 Da and an average molecular mass near 751.9 Da. All seven residues are proteinogenic amino acids, and the molecule carries no modified side chains or non-natural linkages.
== Origin/development == The sulcular epithelium originates developmentally during tooth eruption when the reduced enamel epithelium derived from the enamel organ fuses with the oral epithelium to form a continuous epithelial lining around the tooth. The junctional epithelium is attached coronally to the sulcular epithelium which is thicker. At the bottom of the sulcus is the junctional epithelium in which the development starts with the reduced enamel epithelium the protective layer of epithelial tissue that covers the enamel before the eruption of the tooth forming a seal.The rest of the part separating the junctional epithelium with the oral epithelium at the free gingival margin is covered by the sulcular epithelium. Gingival epithelium complex covers the alveolar bone to the neck of the tooth and the sulcular epithelium is a component or part of this complex which helps in the preservation of periodontal health. The sulcular epithelium is described as stratified but non-keratinized unlike the attached gingival epithelium which is keratinized.The sulcular epithelium expresses a characteristic cytokeratin pattern in particular keratins K4 and K13.
== Production of biopharmaceuticals == Lemna has been transformed by molecular biologists to express proteins of pharmaceutical interest. Expression constructs were engineered to cause Lemna to secrete the transformed proteins into the growth medium at high yield. Since the Lemna is grown on a simple medium, this substantially reduces the burden of protein purification in preparing such proteins for medical use, promising substantial reductions in manufacturing costs. In addition, the host Lemna can be engineered to cause secretion of proteins with human patterns of glycosylation, an improvement over conventional plant gene-expression systems. Several such products are being developed, including monoclonal antibodies.
The bicyclic core of C10-epi-kedarcidin chromophore was prepared by the sequential application of three carbon-carbon bond forming reactions, as shown in the retrosynthetic schematic above. First, a Sonogashira coupling was carried out between a bromovinyl electrophile and alkynyl nucleophile; ring closure to give a cyclic triyne was then accomplished by Glaser coupling of two terminal alkynes. The 5,9-fused bicyclic core was established by in situ generation of a vinyllithium species that underwent transannular 5-exo-dig cyclization.
== Release == Season 3 was promoted with the tagline "May God have mercy". Many of the episode titles are references to Westerns and the Bible. The premiere screened at Coachella 2026 on April 2, 2026. The season had its red carpet premiere on April 7, 2026. In the United States, the season premiered on April 12, 2026, with its finale was released on May 31. In the United Kingdom and the Republic of Ireland, each episode was released at the same time as its U.S. premiere, through Sky Atlantic's streaming service Now.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
==== 2023–24 UEFA Women's Nations League B ==== 23 September – Ireland 3–0 Northern Ireland. 26 September – Hungary 0–4 Ireland. 27 October – Ireland 5–1 Albania. 31 October – Albania 0–1 Ireland. 1 December – Ireland 1–0 Hungary. 5 December – Northern Ireland 1–6 Ireland.
In chemistry, silica gel is used in chromatography as a stationary phase. In column chromatography, the stationary phase is most often composed of silica gel particles of 40–63 μm. Different particle sizes are used for different kinds of column chromatography as the particle size is related to surface area. The differences in particle size dictate if the silica gel should be used for flash or gravity chromatography. In this application, due to silica gel's polarity, non-polar components tend to elute before more polar ones, hence the name normal phase chromatography. However, when hydrophobic groups (such as C18 groups) are attached to the silica gel then polar components elute first and the method is referred to as reverse phase chromatography. Silica gel is also applied to aluminium, glass, or plastic sheets for thin layer chromatography. The hydroxy (OH) groups on the surface of silica can be functionalized to afford specialty silica gels that exhibit unique stationary phase parameters. These so-called functionalized silica gels are also used in organic synthesis and purification as insoluble reagents and scavengers. Chelating groups have also been covalently bound to silica gel. These materials have the ability to remove metal ions selectively from aqueous solutions. Chelating groups can be covalently bound to polyamines that have been grafted onto a silica gel surface producing a material of greater mechanical integrity. Silica gel is also combined with alkali metals to form a M-SG reducing agent.
Radon is a naturally occurring radioactive noble gas discovered in 1900 by Friedrich Ernst Dorn (1848-1916) and is considered carcinogenic. Radon is increasingly found in areas with high levels of uranium and thorium in the soil. These are mainly areas with high granitic rock deposits. According to studies by the World Health Organization, the incidence of lung cancer increases significantly at radiation levels of 100-200 Bq per cubic meter of indoor air. The likelihood of developing lung cancer increases by 10% with each additional 100 Bq/m3 of indoor air.
== Ecology == In nature, A. roeperi is found primarily on the walls of ambrosia beetle galleries within a wide variety of host trees, where it survives by degrading compounds within wood. Traditionally, although they facilitate beetle growth and reproduction in nutritionally poor xylem tissue, ambrosia fungi are considered to be ineffective agents of wood decomposition, producing enzymes primarily dedicated to degradation of xylan, glucomannan, and callose (common components of hemicellulose) rather than cellulose, mirroring similar analyses made for various saprotrophic fungi. However, no equivalent studies have been performed on A. roeperi specifically, and it is worth noting that the article often cited in support of this conclusion only examined the fungal galleries of one beetle (Xyleborinus saxenii) associated with a different symbiont, Raffaelea sulfurea. Interestingly, metabolomic studies incorporating A. roeperi indicate that when growing on wood, this fungus possesses a lipid profile more similar to non-mutualistic Ceratocystidaceae than to other ambrosia fungi, further supporting the idea that making sweeping conclusions about fungal lifestyles based on data from apparently similar convergent systems can be misleading, as well as reinforcing how much remains to be learned about this and other ambrosial species. There are various molecular indications that hint at other ways in which A. roeperi may interact with its woody hosts.
Sources: en.wikipedia.org
== Disease relevance == The presence of serum prolidase in the blood is a good indicator of the presence and severity of many types of diseases. For instance, Type 2 Diabetes mellitus patients have elevated levels of serum prolidase. This is expected because high blood glucose leads to a decrease in collagen production and inflammatory cell generation, which depreciates wound healing ability. Furthermore, Rheumatoid Arthritis, Ankylosing spondylitis, and benign joint hypermobility syndrome have corresponded with low serum prolidase levels. Prolidase has become a prominent marker of cancer progression in patients with various types of cancer. Depending on the elevated levels of serum prolidase in the blood, physicians are able to determine tumor size, stage of cancer, and prognosis, all of which help significantly in treating these diseases. Analysis of serum prolidase levels has been used to detect the severity of liver disease in some instances. Research has indicated the correlation between chronic liver diseases and serum prolidase. For instance, one study suggested an increase in serum prolidase levels during the initial stages of cirrhotic liver fibrosis, followed by a decrease as the disease progressed. Moreover, analysis of serum prolidase levels in alcoholic hepatitis patients has displayed higher levels compared to cirrhosis patients. Serum prolidase is a highly necessary enzyme in the human body. Through its many functions, most notably collagen recycling, prolidase is widely used in the overall metabolism of humans.
=== Pharmacogenetics === Since doxepin is mainly metabolized by CYP2D6, CYP2C9, and CYP2C19, genetic variations within the genes coding for these enzymes can affect its metabolism, leading to changes in the concentrations of the drug in the body. Increased concentrations of doxepin may increase the risk for side effects, including anticholinergic and nervous system adverse effects, while decreased concentrations may reduce the drug's efficacy. Individuals can be categorized into different types of cytochrome P450 metabolizers depending on which genetic variations they carry. These metabolizer types include poor, intermediate, extensive, and ultrarapid metabolizers. Most people are extensive metabolizers, and have "normal" metabolism of doxepin. Poor and intermediate metabolizers have reduced metabolism of the drug as compared to extensive metabolizers; patients with these metabolizer types may have an increased probability of experiencing side effects. Ultrarapid metabolizers break down doxepin much faster than extensive metabolizers; patients with this metabolizer type may have a greater chance of experiencing pharmacological failure. A study assessed the metabolism of a single 75 mg oral dose of doxepin in healthy volunteers with genetic polymorphisms in CYP2D6, CYP2C9, and CYP2C19 enzymes. In CYP2D6 extensive, intermediate, and poor metabolizers, the mean clearance rates of (E)-doxepin were 406, 247, and 127 L/hour, respectively (~3-fold difference between extensive and poor).
In a simultaneous publication, The New York Times and the Washington Post broke the story by Post reporter Alma Guillermoprieto and Times reporter Raymond Bonner about the El Mozote massacre where the army of El Salvador had carried out the mass execution of at least 811 civilians. Dr. Roberto Suazo Cordova was installed as President of Honduras, becoming the first civilian president of the Central American nation since the 1979 military coup that had brought down the previous civilian government. Died: Tran Van Huong, 79, the last President of South Vietnam for seven days (April 21–28, 1975) before the fall of Saigon, and Prime Minister 1964-1965 and 1968–1969, died at his home in Ho Chi Minh City
After independence, the government began a deliberate process of crafting a uniquely Singaporean identity and culture. Singapore has a reputation as a nanny state. The government also places a heavy emphasis on meritocracy, where one is judged based on one's ability. The national flower of Singapore is the hybrid orchid, Vanda Miss Joaquim, named in memory of Agnes Joaquim, who crossbred the flower in her garden at Tanjong Pagar in 1893. Singapore is known as the Lion City and many national symbols such as the coat of arms and the lion head symbol make use of a lion. Major religious festivals are public holidays. UNESCO recognises Singapore as a "Design City."
=== Persistent viruses === Using quantitative polymerase chain reaction (qPCR) and next-generation sequencing (NGS) a maximum of five DNA viruses per individual have been identified. Included were several herpesviruses, hepatitis B virus, Merkel cell polyomavirus, and human papillomavirus 31. Given the reactivation and/or oncogenic potential of these viruses, their repercussion on hematopoietic and malignant disorders calls for further studies.
Sources: en.wikipedia.org
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro, designed as a metabolically stabilized analogue of the endogenous tetrapeptide tuftsin. It has been studied mainly against anxiety-related and cognitive endpoints rather than as an approved medicine in most jurisdictions.
Tuftsin contains four residues, while selank carries an additional Pro-Gly-Pro segment at the carboxyl end. That extension is intended to reduce enzymatic cleavage. Comparative pharmacokinetic data in humans remain limited.
No single receptor target is widely accepted as the definitive mediator of the reported effects. Proposed contributors include GABAergic modulation, shifts in monoamine turnover, and altered neuropeptide degradation. The mechanism is treated in the literature as unresolved.
It is a seven-amino-acid peptide, Thr-Lys-Pro-Arg-Pro-Gly-Pro, produced by chemical synthesis rather than extracted from biological tissue. Its design is based on tuftsin, a natural immunomodulatory tetrapeptide. The C-terminal Pro-Gly-Pro segment is a common stabilising motif in short regulatory peptides.